The slightly lower coverage metrics at a given subsampled read depth for the tailed amplicon v2 method can likely be explained by primer dimer formation during the two-step amplification process, which is more pronounced for higher N1 and N2 Ct samples (Supplemental Fig. A rapid, cost-effective tailed amplicon method for sequencing SARS-CoV-2. Article S5. It is suitable to analyze size, quantity, and integrity of your samples. Visit our TapeStation portfolio page and discover how! S.N. The positive enrichment approach described in this study shows a relatively simple and universal CLas genome enrichment method. Article Gnirke, A. et al. Phytopathology. Hundreds of millions of sequencing reads are needed to get good CLas genome coverage from an infected citrus sample, making CLas genome sequencing challenging and costly18. Percentage of genome coverage at 10x at different subsampled read depths for WA1 and UMGC SARS-CoV-2 isolates sequenced with different methods. Dai, Z. et al. Given the small genome size, the ability to sequence SARS-CoV-2 at scale is limited by the cost and labor associated with making sequencing libraries. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. CAS 1b), in which cDNA is made from SARS-CoV-2 positive samples and amplified using primers that generate tiled PCR products are being used to sequence SARS-CoV-2 [3]. Input material was not sheared, as the amplicons were already the desired fragment length. The need for informed consent was deemed unnecessary by the IRB. Successful grafted citrus trees were determined by HLBaspr real-time quantitative PCR from symptomatic leaves. cDNA synthesis reactions were incubated at: 25C for 10min, followed by 50C for 10min and 85C for 5min. The 4-pool amplification scheme (tailed amplicon v2) achieved coverage metrics close to the untailed ARTIC v3 approach at comparable read depths with 99.60% coverage at a minimum of 10x and 95.64% coverage at a minimum of 100x (Fig. Percentage of genome coverage at 100x at different subsampled read depths for WA1 and UMGC SARS-CoV-2 isolates sequenced with different methods. Cookies policy. Of the seven shared sites missing across samples, four were in prophage regions that could reflect sequence diversity, and the remaining three regions only totaled approximately 200bp. Assefa, S., Keane, T. M., Otto, T. D., Newbold, C. & Berriman, M. ABACAS: algorithm-based automatic contiguation of assembled sequences. For the ARTIC v3, tailed amplicon v1, and tailed amplicon v2 methods, samples were amplified for 35 PCR cycles in the first PCR reaction. Genome Announc. Reactions were run on a QuantStudio QS5 (Thermo Fisher Scientific, Waltham, MA) using the following cycling conditions: one cycle of 45C for 15min, followed by one cycle of 95C for 2min, followed by 45cycles of 95C for 15s and 60C for 1min. The primers for the primary amplification contained both SARS-CoV-2 targeting sequences (derived from the ARTIC v3 designs), as well as adapter tails for adding indices and Illumina flow cell adapters in a secondary amplification. c The tailed amplicon approach, developed here, enriches first strand cDNA using ARTIC v3 primers containing adapter tails. Besides the capability to sequencing medium to low titer samples, the total cost was also reduced by using SureSelect for the whole genome sequencing. We carried out initial tests of the Nextera DNA Flex Enrichment protocol, the tailed amplicon v1 approach, and the ARTIC v3 approach using this sample set. The concentration and sizing is determined from the standard ladder loaded into lane one. We thank California Department of Food and Agriculture (CDFA) for providing the infected citrus samples. The following recipe was used to set up the PCR reactions: 2.5L template cDNA, 14.75L nuclease-free water, 5l 5x Q5 reaction buffer (New England Biolabs, Ipswich, MA), 0.5L 10mM dNTPs (Kapa Biosystems, Woburn, MA), 0.25L Q5 Polymerase (New England Biolabs, Ipswich, MA), 2L primer pool 1 or 2 (10M). It is suitable to analyze size, quantity, and integrity of your samples. Chromatography & Spectroscopy Lab Supplies, GC Calculators & Method Translation Software, BioCalculators / Nucleic Acid Calculators. Does the Agilent 2200 TapeStation make sense for this application? I use the Qiaxcel system. 77, 19101917 (2011). The ARTIC network (https://artic.network/) has established a method for preparing amplicon pools in order to sequence SARS-CoV-2 (Fig. The LHCA strain clusters most closely to the other reported California strains, AHCA1 and SGCA5, however it does form its own distinct clade from those strains too. Article For me the Experion system was more forgiving when it came to chip loading. We thank the staff of the University of Minnesota Genomics Center for helpful discussions and technical support. The system integrates an instrument, data processing software, reagents, and ScreenTape devices specific for DNA and RNA. We selected 9 SARS-CoV-2 positive patient samples spanning a range of viral loads as assessed by a qRT-PCR using the CDC primers targeting the SARS-CoV-2 nucleocapsid gene (N1 and N2 targets, Supplemental Fig. PubMed Agilent TapeStation Software Displays a - Agilent Technologies Consistent with other recent analyses of SARS-CoV-2 amplicon sequencing approaches [17], we observed highly concordant results from samples with N1 and N2 Ct values of less than 30. It is difficult to draw a comparison between alternative methods since only a few multiplex amplicon-based papers to sequence the whole SARS-CoV-2 genome have . Halbert, S. E. The discovery of huanglongbing in Florida. Huanglongbing (HLB) is a worldwide deadly citrus disease caused by the phloem-limited bacteria Candidatus Liberibacter asiaticus (CLas) vectored by Asian citrus psyllids. Liberibacter asiaticus was estimated using HLBaspr real-time quantitative PCR, giving a quantification threshold (Cq) value6. Hadfield J, Megill C, Bell SM, Huddleston J, Potter B, Callender C. et al, Nextstrain: real-time tracking of pathogen evolution. The system integrates an instrument, data processing software, reagents, and ScreenTape devices specific for DNA and RNA. Google Scholar. Nat Biotechnol. The quality control methods from gDNA input to final library using the Agilent Bioanalyzer System and Agilent TapeStation System were evaluated. Applicability of Three Alternative Instruments for Food - Hindawi Next generation sequencing technologies have enabled large-scale genomic surveillance of SARS-CoV-2 as thousands of isolates are being sequenced around the world and deposited in public data repositories. 19(5), 455477 (2012). Here we compare sequence capture and amplicon-based methods for sequencing SARS-CoV-2 and describe a streamlined tailed amplicon method for cost-effective and highly scalable SARS-CoV-2 sequencing. Not surprisingly, we got the same prophage pattern for the SGCA strain sequenced in this study as SGCA5 (SC1 only), another strain from the same location14. Tailed amplicon v2 pool primer sequences. The genetic identity of strains found in new locations or with varying aggressiveness can help inform the effectiveness of quarantine programs and provide researchers with data to search for virulence-associated genetic elements. 2023 BioMed Central Ltd unless otherwise stated. 4150 & 4200 TapeStation Instrument - Elokarsa The first strand synthesis reaction was incubated at 25C for 10min, 42C for 50min, 70C for 15min. bioRxiv. Finally, we examined the variants detected in the patient samples for each of the SARS-CoV-2 sequencing methods. Read-pairs were stitched together using PEAR [20]. 3f, Supplemental Fig. The resulting tree was midpoint rooted and visualized using FigTree v1.4.3 (http://tree.bio.ed.ac.uk/software/figtree/). 4 and 5). I came from a lab in industry that trialed the BioA, TapeStation, Caliper system and Advanced Analytical fragment analyzer. 2019;20:85. https://doi.org/10.1186/s13059-019-1691-6. Agilent 4200 TapeStation | Core Facilities - Arizona State University A-F) Observed read depth for each of the expected amplicons for the indicated sample amplified with the tailed amplicon v1 protocol at a subsampled read depth of 100,000 raw reads. I am a little hesitant to recommend this as the machine is nearly 2 decades old now. Agilent has a new system that fills the same space as the BioAnalyzer but is reportedly simpler and faster. Percentage of genome coverage at 10x at different subsampled read depths for each sample when sequenced using the following approaches: A) Illumina Nextera DNA Enrichment; B) ARTIC v3 with TruSeq library preparation. Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Reference prophage genome sequences were at the top. Were interviewing these experts to gain helpful insights into their complex analysis processes. 2a-b, Supplemental Table1, Supplemental Table2). The following indexing primers were used (X indicates the positions of the 10bp unique dual indices): Forward indexing primer: AATGATACGGCGACCACCGAGATCTACACXXXXXXXXXXTCGTCGGCAGCGTC. More than 90% of SNPs were common between two high titer LHCA and SGCA samples, LHCA20/ LHCA22 and SGCA20/SGCA22 (Fig. However, for samples with N1 and N2 Ct values greater than approximately 30, the number of sequencing reads were substantially reduced and the proportion of reads mapping to the human genome were substantially increased (Supplemental Fig. This is exemplified by the CLas genome of the lowest titer sample (equivalent to 28.52 Cq using Li 16S qPCR) being easily obtained with just 3.2 million total reads. Need Help? RNA was extracted using one of three kits (Qiagen QIAamp Viral RNA Mini kit, Macherey-Nagel Nucelospin Virus Mini kit, and Biomrieux easyMag NucliSENS system) as described previously [18]. Start here to learn about Agilent TapeStation system, an automated electrophoresis system that delivers sample quality control (QC) for DNA & RNA applications. Four different Cq value (20.1, 22.84, 26.84, and 28.52) LHCA strain samples and two different Cq value (20.61 and 22.16) SGCA samples were selected to assess the sensitivity and selectivity of whole-genome enrichment and sequencing. The probe set here use the SC1, SC2 and JXGC-3 as three prophage reference genomes, but we anticipate that it would capture all type 1, type 2 and type 3 prophage sequences if present in the samples. The marker is used to align the samples. 30(9), 13121313 (2014). S2-S3). Eight samples with >1ng/L concentration of target amplicons were selected for downstream library preparation. With positive target selection, the probe-bound DNA is eluted and collected for further NGS application, and often has much higher target DNA concentration than the original input samples19,20. M.S. For each CLas samples, gray graphs represent read coverage in log scale. 2020:114. After size selection and an initial size distribution quantification with an Agilent TapeStation (see . This was exemplified by the phylogenetic analysis showing samples from two different locations clustering separately from one another (diversity retained), yet sequencing the same sample at different titer levels clustered together (reproducible results). Despite observing negligible amounts of primer dimer products on the bioanalyzer trace, samples with N1 and N2 Ct values greater than 30 had as much as 50% primer dimer in the resulting sequencing reads. Gottwald, T.R, da Graa, J.V, & Bassanezi, R.B. Filtered high quality reads were mapped to the HLB Psy62 strain reference genome (GenBank accession number GCA_000023765.2) using bowtie2 v2.3.3 in sensitive mode23. The tailed amplicon method we describe represents a cost-effective and highly scalable method for SARS-CoV-2 sequencing. Here we describe an all-amplicon method for producing SARS-CoV-2 sequencing libraries which simplifies the process and lowers the per sample cost for sequencing SARS-CoV-2 genomes (Fig. b In the ARTIC protocol, first strand cDNA is enriched by amplifying with two pools of primers to generate amplicons tiling the SARS-CoV-2 genome. These amplicons are then subjected to either Illumina or Oxford Nanopore library preparation, using methods that either directly add adapters to the ends of the amplicons or to fragment them to enable sequencing on a wider variety of Illumina instruments. 10L of PCR product for each sample was normalized using a SequalPrep 96-well Normalization Plate Kit (Thermo Fisher Scientific, Waltham, MA). Optical and PCR duplicates were flagged in alignment files using Picard v.2.10.5 (http://broadinstitute.github.io/picard). W.C., S.N., J.R. and M.S., wrote and revised the manuscript. Although the mapping tracks show some different gaps among different strains suggesting uncovered non-conserved regions, the probes still capture sufficient prophage sequences for diversity analysis. It does use gel capillaries and the array lasts for only 6 months at a time so if you are not a high volume user, it might not be as cost effective as it is for me. Briefly, three separate 10L RT-qPCR reactions were set up in a 384-well Barcoded plate (Thermo Fisher Scientific, Waltham, MA) for either the N1, N2, or RP primers and probes. 25(15), 19681969 (2009). The ARTIC v3 primers have been through multiple cycles of iteration to achieve relatively even amplicon balance and genome coverage [13]. You are currently viewing the SEQanswers forums as a guest, which limits your access. The sample pools were diluted to 2nM based on the Qubit measurements and Agilent sizing information, and 10L of the 2nM pool was denatured with 10L of 0.2N NaOH. We next tested whether splitting the tailed SARS-CoV-2 primers into 4 PCR reactions based on primer performance in the initial sequencing tests could improve balance with the tailed primer approach. Data Interpretation | Center for Quantitative Life Sciences | Oregon Samples for initial SARS-CoV-2 sequencing workflow tests. C) Tailed amplicon v1 (2 pool amplification); D) Tailed amplicon v2 (4 pool amplification). 31(22), 36913693 (2015). Phylogenies were generated with all samples and 11 published genomes (TableS2) using two methods, core SNPs and the pan-genome. The Nextera DNA Flex Enrichment libraries were analyzed using the same process, except the iVar primer trimming step was omitted, and no filtering of variants or trimming of consensus sequence was performed. SureSelect targeted enrichment, a new cost effective method for the whole genome sequencing of, https://doi.org/10.1038/s41598-019-55144-4. ISSN 2045-2322 (online). To generate cDNA upstream of SARS-CoV-2 genome amplification, the following reaction was set up: 5L template RNA, 11L nuclease-free water, 4L SuperScript IV VILO master mix (Thermo Fisher Scientific, Waltham, MA). Curr Microbiol. The system integrates an instrument, data processing software, reagents, and ScreenTape devices specific for DNA and RNA. Bead beating is the most common alternative to enzymatic lysis for DNA extraction from stool. Gohl DM, Magli A, Garbe J, Becker A, Johnson DM, Anderson S, et al. Providing strain identification can help inform pathogen dissemination. High quality libraries were identified with an Agilent TapeStation using High Sensitivity D 1000 ScreenTape and then pooled for sequencing. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
Is Trunk Bay Located In The Northern Hemisphere,
Apple Valley, Mn Police Scanner,
Scream 3 Original Script Stu,
Articles A